Triplex formation of an oligonucleotide containing 2'-O-methylpseudoisocytidine with a DNA duplex at neutral pH
摘要:
The synthesis of the hexadecanucleotide 5'TTTT1TTTT111111T3' (1-16mer) containing 2-amino-5-(2-O-methyl-beta-D-ribofuranosyl)-4(1H)-pyrimidinone (2'-O-methylpseudoisocytidine or 1) is described. Triplex formation of 1-16mer with a deoxyribonucleotide duplex 5'd(ACCAAAAGAAAAGGGGGGACCA)3'-5'd-(TGGTCCCCCCTTTTCTTTTGGT)3' (duplex-22) which contains the "polypurine tract" found in the genome of human T-cell leukaemia (lymphotropic) virus (HTLV-III) was studied by thermal denaturation and circular dichroiam (CD) spectra in aqueous solution at neutral pH. The "polypurine tract" contains a homoguanine cluster consisting of 6 deoxyguanine residues. The results indicate that 1-16mer and duplex-22 formed a triplex at neutral condition (0.01 M Na cacodylate, 0.5 M NaCl, 5 mM MgCl2, pH 7.2. T(m) = 20-degrees-C). In contrast, a hexadecadeoxynucleotide, 5'TTTTMTTTTMMMMMMT3'(M-16mer), containing 5-methyl-2-deoxycytidine (M) did not form a stable triplex with duplex-22 at the same condition (T(m) < 0-degrees-C). The CD mixing titration indicated that the triplex was formed with 1:1 (duplex:third strand) molecular stoichiometry.
Triplex formation of oligonucleotides containing 2'-O-methylpseudoisocytidine in substitution for 2'-deoxycytidine
作者:Akira Ono、Paul O. P. Ts'o、Lou Sing Kan
DOI:10.1021/ja00010a077
日期:1991.5
Triplex formation of an oligonucleotide containing 2'-O-methylpseudoisocytidine with a DNA duplex at neutral pH
作者:Akira Ono、Paul O. P. Ts'o、Lou Sing Kan
DOI:10.1021/jo00037a048
日期:1992.5
The synthesis of the hexadecanucleotide 5'TTTT1TTTT111111T3' (1-16mer) containing 2-amino-5-(2-O-methyl-beta-D-ribofuranosyl)-4(1H)-pyrimidinone (2'-O-methylpseudoisocytidine or 1) is described. Triplex formation of 1-16mer with a deoxyribonucleotide duplex 5'd(ACCAAAAGAAAAGGGGGGACCA)3'-5'd-(TGGTCCCCCCTTTTCTTTTGGT)3' (duplex-22) which contains the "polypurine tract" found in the genome of human T-cell leukaemia (lymphotropic) virus (HTLV-III) was studied by thermal denaturation and circular dichroiam (CD) spectra in aqueous solution at neutral pH. The "polypurine tract" contains a homoguanine cluster consisting of 6 deoxyguanine residues. The results indicate that 1-16mer and duplex-22 formed a triplex at neutral condition (0.01 M Na cacodylate, 0.5 M NaCl, 5 mM MgCl2, pH 7.2. T(m) = 20-degrees-C). In contrast, a hexadecadeoxynucleotide, 5'TTTTMTTTTMMMMMMT3'(M-16mer), containing 5-methyl-2-deoxycytidine (M) did not form a stable triplex with duplex-22 at the same condition (T(m) < 0-degrees-C). The CD mixing titration indicated that the triplex was formed with 1:1 (duplex:third strand) molecular stoichiometry.